Volume 72 no 6, p.413-419, 2019. Page 418, Acknowledgments “We would like to thank all staff and members of the Department of Virology, NEKKEN, Nagasaki University, Japan for providing technical support and advice. Our special thanks to the staff of the Pavilion II and the Central Laboratory of San Lazaro Hospital for their kind assistance during patient recruitment and data collection.

We are also very grateful for the support of the Senior Vice President and Head of Research and Biotechnology (R&B) Group of St. Luke’s Medical Center, Dr. Isaac David E. Ampil II. Finally, our sincere thanks to the members of R&B’s dengue research group for kindly preparing the samples to be transported to NEKKEN.” should read “This research was supported by grants from the Japan Agency for Medical Research and Development (AMED) under Grant Number JP18fm0108001, JP19fm0108001 (Japan Initiative for Global Research Network on Infectious Diseases (J-GRID)), AMED Research on Emerging and Re-emerging Infectious Diseases (19fk0108035j0003) and e-ASIA Joint Research Program and; Philippine Council for Health Research and Development (PCHRD) of the Department of Science and Technology (DOST), Philippines, with partial support from the Research and Biotechnology of St. Luke’s Medical Center (R&B-SLMC), Philippines (Project No. 07-024).”

AAAS antibody

38905-100ul 100ul
EUR 252

AAAS Antibody

1-CSB-PA004655
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

AAAS Antibody

1-CSB-PA001010GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

AAAS Antibody

1-CSB-PA878867ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

AAAS Antibody

1-CSB-PA798772
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

AAAS Antibody

DF9182 200ul
EUR 304
Description: AAAS Antibody detects endogenous levels of total AAAS.

AAAS Antibody

1-CSB-PA211579
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

AAAS siRNA

20-abx906235
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AAAS siRNA

20-abx906236
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AAAS Antibody

ABD9182 100 ug
EUR 438

pOTB7-AAAS

PVT18761 2 ug
EUR 231

AAAS Blocking Peptide

DF9182-BP 1mg
EUR 195

Aladin (AAAS) Antibody

20-abx004920
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aladin (AAAS) Antibody

20-abx116774
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

AAAS Conjugated Antibody

C36054 100ul
EUR 397

AAAS Conjugated Antibody

C38905 100ul
EUR 397

Aladin (AAAS) Antibody

20-abx322239
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aladin (AAAS) Antibody

abx230275-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

AAAS cloning plasmid

CSB-CL878867HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1641
  • Sequence: atgtgctctctggggttgttccctcctccaccgcctcggggtcaagtcaccctatatgagcacaataacgagctggtgacgggcagtagctatgagagcccgccccccgacttccggggccagtggatcaatcttcctgtcctacaactgacaaaggatcccctaaagacccctg
  • Show more
Description: A cloning plasmid for the AAAS gene.

AAAS Rabbit pAb

A6427-100ul 100 ul
EUR 308

AAAS Rabbit pAb

A6427-200ul 200 ul
EUR 459

AAAS Rabbit pAb

A6427-20ul 20 ul
EUR 183

AAAS Rabbit pAb

A6427-50ul 50 ul
EUR 223

Anti-AAAS antibody

STJ28510 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene.

AAAS ELISA KIT|Human

EF004559 96 Tests
EUR 689

Human AAAS shRNA Plasmid

20-abx955363
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AAAS shRNA Plasmid

20-abx981305
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AAAS Recombinant Protein (Human)

RP000013 100 ug Ask for price

AAAS Recombinant Protein (Mouse)

RP113162 100 ug Ask for price

AAAS Recombinant Protein (Rat)

RP188444 100 ug Ask for price

Rat Aladin(AAAS) ELISA kit

E02A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aladin(AAAS) ELISA kit

E02A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aladin(AAAS) ELISA kit

E02A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aladin(AAAS) ELISA kit

E04A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aladin(AAAS) ELISA kit

E04A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aladin(AAAS) ELISA kit

E04A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aladin(AAAS) ELISA kit

E06A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aladin(AAAS) ELISA kit

E06A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aladin(AAAS) ELISA kit

E06A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit

E03A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit

E03A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit

E03A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit

E01A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit

E01A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit

E01A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aladin(AAAS) ELISA kit

E08A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aladin(AAAS) ELISA kit

E08A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aladin(AAAS) ELISA kit

E08A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aladin(AAAS) ELISA kit

E09A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aladin(AAAS) ELISA kit

E09A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aladin(AAAS) ELISA kit

E09A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aladin(AAAS) ELISA kit

E07A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aladin(AAAS) ELISA kit

E07A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aladin(AAAS) ELISA kit

E07A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin, Aaas ELISA KIT

ELI-24645m 96 Tests
EUR 865

Human Aladin, AAAS ELISA KIT

ELI-24761h 96 Tests
EUR 824

Human Aladin (AAAS) ELISA Kit

abx392195-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Aladin (AAAS) ELISA Kit

abx388488-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Polyclonal AAAS Antibody (C-Term)

AMM05524G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AAAS (C-Term). This antibody is tested and proven to work in the following applications:

Aaas ORF Vector (Rat) (pORF)

ORF062816 1.0 ug DNA
EUR 506

AAAS ORF Vector (Human) (pORF)

ORF000005 1.0 ug DNA
EUR 95

Aaas ORF Vector (Mouse) (pORF)

ORF037722 1.0 ug DNA
EUR 506

Guinea pig Aladin(AAAS) ELISA kit

E05A1113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aladin(AAAS) ELISA kit

E05A1113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aladin(AAAS) ELISA kit

E05A1113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Aladin WD Repeat Nucleoporin (AAAS) Antibody

20-abx211546
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aladin WD Repeat Nucleoporin (AAAS) Antibody

20-abx211894
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aladin WD Repeat Nucleoporin (AAAS) Antibody

20-abx330148
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aaas sgRNA CRISPR Lentivector set (Rat)

K7564801 3 x 1.0 ug
EUR 339

Aaas sgRNA CRISPR Lentivector set (Mouse)

K4495301 3 x 1.0 ug
EUR 339

AAAS sgRNA CRISPR Lentivector set (Human)

K0014301 3 x 1.0 ug
EUR 339

Aaas ELISA Kit| Mouse Aladin ELISA Kit

EF014113 96 Tests
EUR 689

Monoclonal AAAS Antibody (monoclonal) (M02), Clone: 5A1

AMM05525G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human AAAS (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5A1. This antibody is applicable in WB and IHC, E

Aaas sgRNA CRISPR Lentivector (Rat) (Target 1)

K7564802 1.0 ug DNA
EUR 154

Aaas sgRNA CRISPR Lentivector (Rat) (Target 2)

K7564803 1.0 ug DNA
EUR 154

Aaas sgRNA CRISPR Lentivector (Rat) (Target 3)

K7564804 1.0 ug DNA
EUR 154

Aaas sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4495302 1.0 ug DNA
EUR 154

Aaas sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4495303 1.0 ug DNA
EUR 154

Aaas sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4495304 1.0 ug DNA
EUR 154

AAAS sgRNA CRISPR Lentivector (Human) (Target 1)

K0014302 1.0 ug DNA
EUR 154

AAAS sgRNA CRISPR Lentivector (Human) (Target 2)

K0014303 1.0 ug DNA
EUR 154

AAAS sgRNA CRISPR Lentivector (Human) (Target 3)

K0014304 1.0 ug DNA
EUR 154

AAAS Protein Vector (Human) (pPB-C-His)

PV000017 500 ng
EUR 329

AAAS Protein Vector (Human) (pPB-N-His)

PV000018 500 ng
EUR 329

AAAS Protein Vector (Human) (pPM-C-HA)

PV000019 500 ng
EUR 329

AAAS Protein Vector (Human) (pPM-C-His)

PV000020 500 ng
EUR 329

AAAS Protein Vector (Mouse) (pPB-C-His)

PV150886 500 ng
EUR 603

AAAS Protein Vector (Mouse) (pPB-N-His)

PV150887 500 ng
EUR 603

AAAS Protein Vector (Mouse) (pPM-C-HA)

PV150888 500 ng
EUR 603

AAAS Protein Vector (Mouse) (pPM-C-His)

PV150889 500 ng
EUR 603

AAAS Protein Vector (Rat) (pPB-C-His)

PV251262 500 ng
EUR 603

AAAS Protein Vector (Rat) (pPB-N-His)

PV251263 500 ng
EUR 603

AAAS Protein Vector (Rat) (pPM-C-HA)

PV251264 500 ng
EUR 603

AAAS Protein Vector (Rat) (pPM-C-His)

PV251265 500 ng
EUR 603

AAAS Protein Vector (Human) (pPB-His-MBP)

PV318526 500 ng
EUR 329

AAAS Protein Vector (Human) (pPB-His-GST)

PV318527 500 ng
EUR 329

Aaas 3'UTR Luciferase Stable Cell Line

TU101107 1.0 ml Ask for price

Aaas 3'UTR GFP Stable Cell Line

TU151107 1.0 ml Ask for price

Aaas 3'UTR Luciferase Stable Cell Line

TU200011 1.0 ml Ask for price

Aaas 3'UTR GFP Stable Cell Line

TU250011 1.0 ml Ask for price

AAAS 3'UTR GFP Stable Cell Line

TU050011 1.0 ml
EUR 1394

AAAS 3'UTR Luciferase Stable Cell Line

TU000011 1.0 ml
EUR 1394

AAAS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669589 1.0 ug DNA
EUR 682

AAAS Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669593 1.0 ug DNA
EUR 682

AAAS Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669594 1.0 ug DNA
EUR 682

AAAS Protein Vector (Human) (pPM-N-D-C-HA)

PV318528 500 ng
EUR 552

AAAS Protein Vector (Human) (pPM-N-D-C-His)

PV318529 500 ng
EUR 552

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7564805 3 x 1.0 ug
EUR 376

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4495305 3 x 1.0 ug
EUR 376

AAAS sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0014305 3 x 1.0 ug
EUR 376

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7564806 1.0 ug DNA
EUR 167

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7564807 1.0 ug DNA
EUR 167

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7564808 1.0 ug DNA
EUR 167

AAAS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV669590 1.0 ug DNA
EUR 682

AAAS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV669591 1.0 ug DNA
EUR 740

AAAS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV669592 1.0 ug DNA
EUR 740

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4495306 1.0 ug DNA
EUR 167

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4495307 1.0 ug DNA
EUR 167