An Epidemic of Dengue Virus Serotype-4 during the 2015 – 2017: the Emergence of a Novel Genotype IIa of DENV-4 in the Philippines.

Volume 72 no 6, p.413-419, 2019. Page 418, Acknowledgments “We would like to thank all staff and members of the Department of Virology, NEKKEN, Nagasaki University, Japan for providing technical support and advice. Our special thanks to the staff of the Pavilion II and the Central Laboratory of San Lazaro Hospital for their kind assistance during patient recruitment and data collection.

We are also very grateful for the support of the Senior Vice President and Head of Research and Biotechnology (R&B) Group of St. Luke’s Medical Center, Dr. Isaac David E. Ampil II. Finally, our sincere thanks to the members of R&B’s dengue research group for kindly preparing the samples to be transported to NEKKEN.” should read “This research was supported by grants from the Japan Agency for Medical Research and Development (AMED) under Grant Number JP18fm0108001, JP19fm0108001 (Japan Initiative for Global Research Network on Infectious Diseases (J-GRID)), AMED Research on Emerging and Re-emerging Infectious Diseases (19fk0108035j0003) and e-ASIA Joint Research Program and; Philippine Council for Health Research and Development (PCHRD) of the Department of Science and Technology (DOST), Philippines, with partial support from the Research and Biotechnology of St. Luke’s Medical Center (R&B-SLMC), Philippines (Project No. 07-024).”

AAAS antibody
38905-100ul	SAB	100ul	EUR 252.00

AAAS Antibody
ABD9182	Lifescience Market	100 ug	EUR 438.00

AAAS Antibody
1-CSB-PA878867ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

AAAS Antibody
1-CSB-PA798772	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

AAAS Antibody
1-CSB-PA001010GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

AAAS Antibody
36054-100ul	SAB	100ul	EUR 252.00

AAAS antibody
70R-15492	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal AAAS antibody

AAAS Antibody
1-CSB-PA004655	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

AAAS Antibody
1-CSB-PA211579	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

pOTB7-AAAS
PVT18761	Lifescience Market	2 ug	EUR 231.00

AAAS Antibody
DF9182	Affbiotech	200ul	EUR 304.00
Description: AAAS Antibody detects endogenous levels of total AAAS.

Aladin (AAAS) Antibody
abx230275-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Aladin (AAAS) Antibody
20-abx004920	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Aladin (AAAS) Antibody
20-abx322239	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

AAAS Polyclonal Antibody
E-AB-33314-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: Adracalin (AAAS) is expressed in both neuroendocrine and cerebral structures and may functio Show more
Description: Rabbit antibody against Human,Rat AAAS for WB,ELISA applications.

AAAS Polyclonal Antibody
E-AB-33314-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: Adracalin (AAAS) is expressed in both neuroendocrine and cerebral structures and may functio Show more
Description: Rabbit antibody against Human,Rat AAAS for WB,ELISA applications.

AAAS Polyclonal Antibody
E-AB-33314-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: Adracalin (AAAS) is expressed in both neuroendocrine and cerebral structures and may functio Show more
Description: Rabbit antibody against Human,Rat AAAS for WB,ELISA applications.

AAAS Polyclonal Antibody
E-AB-10745-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be in Show more
Description: Rabbit antibody against Human,Mouse AAAS for WB,IHC,ELISA applications.

AAAS Polyclonal Antibody
E-AB-10745-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be in Show more
Description: Rabbit antibody against Human,Mouse AAAS for WB,IHC,ELISA applications.

AAAS Polyclonal Antibody
E-AB-10745-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be in Show more
Description: Rabbit antibody against Human,Mouse AAAS for WB,IHC,ELISA applications.

AAAS cloning plasmid
CSB-CL878867HU-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1641 Sequence: atgtgctctctggggttgttccctcctccaccgcctcggggtcaagtcaccctatatgagcacaataacgagctggtgacgggcagtagctatgagagcccgccccccgacttccggggccagtggatcaatcttcctgtcctacaactgacaaaggatcccctaaagacccctg Show more
Description: A cloning plasmid for the AAAS gene.

AAAS Conjugated Antibody
C36054	SAB	100ul	EUR 397.00

AAAS Conjugated Antibody
C38905	SAB	100ul	EUR 397.00

Aladin (AAAS) Antibody
20-abx116774	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

AAAS Rabbit pAb
A6427-100ul	Abclonal	100 ul	EUR 308.00

AAAS Rabbit pAb
A6427-200ul	Abclonal	200 ul	EUR 459.00

AAAS Rabbit pAb
A6427-20ul	Abclonal	20 ul	EUR 183.00

AAAS Rabbit pAb
A6427-50ul	Abclonal	50 ul	EUR 223.00

AAAS Blocking Peptide
DF9182-BP	Affbiotech	1mg	EUR 195.00

Anti-AAAS antibody
STJ28510	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene.

AAAS ELISA KIT|Human
EF004559	Lifescience Market	96 Tests	EUR 689.00

Mouse AAAS shRNA Plasmid
20-abx981305	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human AAAS shRNA Plasmid
20-abx955363	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AAAS Recombinant Protein (Human)
RP000013	ABM	100 ug	Ask for price

AAAS Recombinant Protein (Mouse)
RP113162	ABM	100 ug	Ask for price

AAAS Recombinant Protein (Rat)
RP188444	ABM	100 ug	Ask for price

Human Aladin(AAAS) ELISA kit
E01A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit
E01A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit
E01A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin, Aaas ELISA KIT
ELI-24645m	Lifescience Market	96 Tests	EUR 865.00

Human Aladin, AAAS ELISA KIT
ELI-24761h	Lifescience Market	96 Tests	EUR 824.00

Rat Aladin(AAAS) ELISA kit
E02A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aladin(AAAS) ELISA kit
E02A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aladin(AAAS) ELISA kit
E02A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit
E03A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit
E03A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit
E03A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aladin(AAAS) ELISA kit
E04A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aladin(AAAS) ELISA kit
E04A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aladin(AAAS) ELISA kit
E04A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aladin(AAAS) ELISA kit
E07A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aladin(AAAS) ELISA kit
E07A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aladin(AAAS) ELISA kit
E07A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aladin(AAAS) ELISA kit
E06A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aladin(AAAS) ELISA kit
E06A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aladin(AAAS) ELISA kit
E06A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aladin(AAAS) ELISA kit
E08A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aladin(AAAS) ELISA kit
E08A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aladin(AAAS) ELISA kit
E08A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aladin(AAAS) ELISA kit
E09A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aladin(AAAS) ELISA kit
E09A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aladin(AAAS) ELISA kit
E09A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin (AAAS) ELISA Kit
abx388488-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human Aladin (AAAS) ELISA Kit
abx392195-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Aaas ORF Vector (Rat) (pORF)
ORF062816	ABM	1.0 ug DNA	EUR 506.00

AAAS ORF Vector (Human) (pORF)
ORF000005	ABM	1.0 ug DNA	EUR 95.00

Aaas ORF Vector (Mouse) (pORF)
ORF037722	ABM	1.0 ug DNA	EUR 506.00

Polyclonal AAAS Antibody (C-Term)
AMM05524G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AAAS (C-Term). This antibody is tested and proven to work in the following applications:

Aladin WD Repeat Nucleoporin (AAAS) Antibody
20-abx211546	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Aladin WD Repeat Nucleoporin (AAAS) Antibody
20-abx211894	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Guinea pig Aladin(AAAS) ELISA kit
E05A1113-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aladin(AAAS) ELISA kit
E05A1113-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aladin(AAAS) ELISA kit
E05A1113-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Aladin WD Repeat Nucleoporin (AAAS) Antibody
20-abx330148	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

AAAS sgRNA CRISPR Lentivector set (Human)
K0014301	ABM	3 x 1.0 ug	EUR 339.00

Aaas sgRNA CRISPR Lentivector set (Mouse)
K4495301	ABM	3 x 1.0 ug	EUR 339.00

Aaas sgRNA CRISPR Lentivector set (Rat)
K7564801	ABM	3 x 1.0 ug	EUR 339.00

Aaas ELISA Kit| Mouse Aladin ELISA Kit
EF014113	Lifescience Market	96 Tests	EUR 689.00

AAAS sgRNA CRISPR Lentivector (Human) (Target 1)
K0014302	ABM	1.0 ug DNA	EUR 154.00

AAAS sgRNA CRISPR Lentivector (Human) (Target 2)
K0014303	ABM	1.0 ug DNA	EUR 154.00

AAAS sgRNA CRISPR Lentivector (Human) (Target 3)
K0014304	ABM	1.0 ug DNA	EUR 154.00

Aaas sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4495302	ABM	1.0 ug DNA	EUR 154.00

Aaas sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4495303	ABM	1.0 ug DNA	EUR 154.00

Aaas sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4495304	ABM	1.0 ug DNA	EUR 154.00

Aaas sgRNA CRISPR Lentivector (Rat) (Target 1)
K7564802	ABM	1.0 ug DNA	EUR 154.00

Aaas sgRNA CRISPR Lentivector (Rat) (Target 2)
K7564803	ABM	1.0 ug DNA	EUR 154.00

Aaas sgRNA CRISPR Lentivector (Rat) (Target 3)
K7564804	ABM	1.0 ug DNA	EUR 154.00

AAAS Protein Vector (Rat) (pPB-C-His)
PV251262	ABM	500 ng	EUR 603.00

AAAS Protein Vector (Rat) (pPB-N-His)
PV251263	ABM	500 ng	EUR 603.00

AAAS Protein Vector (Rat) (pPM-C-HA)
PV251264	ABM	500 ng	EUR 603.00

AAAS Protein Vector (Rat) (pPM-C-His)
PV251265	ABM	500 ng	EUR 603.00

AAAS Protein Vector (Human) (pPB-His-MBP)
PV318526	ABM	500 ng	EUR 329.00

AAAS Protein Vector (Human) (pPB-His-GST)
PV318527	ABM	500 ng	EUR 329.00

AAAS Protein Vector (Mouse) (pPB-C-His)
PV150886	ABM	500 ng	EUR 603.00

AAAS Protein Vector (Mouse) (pPB-N-His)
PV150887	ABM	500 ng	EUR 603.00

AAAS Protein Vector (Mouse) (pPM-C-HA)
PV150888	ABM	500 ng	EUR 603.00

AAAS Protein Vector (Mouse) (pPM-C-His)
PV150889	ABM	500 ng	EUR 603.00

AAAS 3'UTR Luciferase Stable Cell Line
TU000011	ABM	1.0 ml	EUR 1394.00

AAAS 3'UTR GFP Stable Cell Line
TU050011	ABM	1.0 ml	EUR 1394.00

Aaas 3'UTR Luciferase Stable Cell Line
TU101107	ABM	1.0 ml	Ask for price

Aaas 3'UTR Luciferase Stable Cell Line
TU200011	ABM	1.0 ml	Ask for price

Aaas 3'UTR GFP Stable Cell Line
TU250011	ABM	1.0 ml	Ask for price

Aaas 3'UTR GFP Stable Cell Line
TU151107	ABM	1.0 ml	Ask for price

AAAS Protein Vector (Human) (pPB-C-His)
PV000017	ABM	500 ng	EUR 329.00

AAAS Protein Vector (Human) (pPB-N-His)
PV000018	ABM	500 ng	EUR 329.00

AAAS Protein Vector (Human) (pPM-C-HA)
PV000019	ABM	500 ng	EUR 329.00

AAAS Protein Vector (Human) (pPM-C-His)
PV000020	ABM	500 ng	EUR 329.00

Monoclonal AAAS Antibody (monoclonal) (M02), Clone: 5A1
AMM05525G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human AAAS (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5A1. This antibody is applicable in WB and IHC, E

AAAS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV669589	ABM	1.0 ug DNA	EUR 682.00

AAAS Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV669593	ABM	1.0 ug DNA	EUR 682.00

AAAS Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV669594	ABM	1.0 ug DNA	EUR 682.00

AAAS Protein Vector (Human) (pPM-N-D-C-HA)
PV318528	ABM	500 ng	EUR 552.00

AAAS Protein Vector (Human) (pPM-N-D-C-His)
PV318529	ABM	500 ng	EUR 552.00

AAAS sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0014305	ABM	3 x 1.0 ug	EUR 376.00

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4495305	ABM	3 x 1.0 ug	EUR 376.00

Aaas sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7564805	ABM	3 x 1.0 ug	EUR 376.00

AAAS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0014306	ABM	1.0 ug DNA	EUR 167.00

AAAS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0014307	ABM	1.0 ug DNA	EUR 167.00