Bioinformatic analysis indicates that SARS-CoV-2 is unrelated to known artificial coronaviruses.

SARS-CoV-2 is responsible for the present coronavirus pandemic and some suggestions were made about its possible artificial origin. We, therefore, compared SARS-CoV-2 with such known viruses that were prepared in the laboratory and other relevant natural strains to estimate their genetic relatedness.

BLAST and clustalW were used to identify and align viral sequences of SARS-CoV-2 to other animal coronaviruses (human, bat, mouse, pangolin) and related artificial constructs. Phylogenetics trees were then prepared using iTOL.Our study supports the notion that known artificial coronaviruses, including the chimeric SL-SHC014-MA15 synthesized in 2015, differ too much from SARS-CoV-2 to hypothesize an artificial origin of the latter.

On the contrary, our data support the natural origin of the COVID-19 virus, likely derived from bats, possibly transferred to pangolins, before spreading to man.Speculations about the artificial origin of SARS-CoV-2 are most likely unfounded.

A4GNT antibody

70R-34020 100 ug
EUR 327.00
Description: Rabbit polyclonal A4GNT antibody

A4GNT antibody

70R-36130 100 ug
EUR 349.00
Description: Rabbit polyclonal A4GNT antibody

A4GNT antibody

70R-7408 50 ug
EUR 467.00
Description: Rabbit polyclonal A4GNT antibody raised against the N terminal of A4GNT

A4GNT antibody

70R-7409 50 ug
EUR 467.00
Description: Rabbit polyclonal A4GNT antibody raised against the C terminal of A4GNT

A4GNT Antibody

ABD3762 100 ug
EUR 438.00

A4GNT Antibody

1-CSB-PA703896
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

A4GNT Antibody

CSB-PA797885-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

A4GNT Antibody

CSB-PA797885-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

A4GNT Antibody

1-CSB-PA001009LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

A4GNT Antibody

34406-100ul 100ul
EUR 252.00

A4GNT Antibody

34406-50ul 50ul
EUR 187.00

A4GNT Antibody

1-CSB-PA072731
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

A4GNT Antibody

1-CSB-PA020263
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

A4GNT Antibody

DF3762 200ul
EUR 304.00
Description: A4GNT Antibody detects endogenous levels of total A4GNT.

A4GNT Blocking Peptide

20-abx063854
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

A4GNT Polyclonal Antibody

A62026 100 µg
EUR 570.55
Description: fast delivery possible

A4GNT Polyclonal Antibody

E-AB-10689-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of
  • Show more
Description: Rabbit antibody against Human A4GNT for IHC,ELISA applications.

A4GNT Polyclonal Antibody

E-AB-10689-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of
  • Show more
Description: Rabbit antibody against Human A4GNT for IHC,ELISA applications.

A4GNT Polyclonal Antibody

E-AB-10689-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of
  • Show more
Description: Rabbit antibody against Human A4GNT for IHC,ELISA applications.

A4GNT Conjugated Antibody

C34406 100ul
EUR 397.00

A4GNT Blocking Peptide

33R-6732 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A4GNT antibody, catalog no. 70R-7409

A4GNT Blocking Peptide

33R-5167 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A4GNT antibody, catalog no. 70R-7408

A4GNT cloning plasmid

CSB-CL001009HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1023
  • Sequence: ATGCGGAAGGAGCTCCAGCTCTCCCTGTCAGTCACCTTGCTGCTTGTCTGTGGCTTCCTCTACCAGTTCACCCTGAAGTCCAGCTGCCTCTTCTGCTTGCCTTCTTTCAAGTCCCACCAGGGGCTGGAAGCCCTCCTGAGCCACAGACGTGGCATTGTGTTTCTAGAGACCTCAG
  • Show more
Description: A cloning plasmid for the A4GNT gene.

A4GNT Blocking Peptide

DF3762-BP 1mg
EUR 195.00

Anti-A4GNT antibody

PAab00015 100 ug
EUR 355.00

A4GNT Rabbit pAb

A12366-100ul 100 ul
EUR 308.00

A4GNT Rabbit pAb

A12366-200ul 200 ul
EUR 459.00

A4GNT Rabbit pAb

A12366-20ul 20 ul
EUR 183.00

A4GNT Rabbit pAb

A12366-50ul 50 ul
EUR 223.00

anti- A4GNT antibody

FNab00015 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: alpha-1,4-N-acetylglucosaminyltransferase
  • Uniprot ID: Q9UNA3
  • Gene ID: 51146
  • Research Area: Metabolism
Description: Antibody raised against A4GNT

Anti-A4GNT antibody

STJ114244 100 µl
EUR 277.00
Description: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O-glycans. It forms a unique glycan, GlcNAcalpha1-->4Galbeta-->R and is largely associated with the Golgi apparatus membrane.

Polyclonal A4GNT Antibody

APG01408G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human A4GNT . This antibody is tested and proven to work in the following applications:

A4GNT ELISA KIT|Human

EF007514 96 Tests
EUR 689.00

A4GNT Antibody, HRP conjugated

1-CSB-PA001009LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

A4GNT Antibody, FITC conjugated

1-CSB-PA001009LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

A4GNT Antibody, Biotin conjugated

1-CSB-PA001009LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human A4GNT shRNA Plasmid

20-abx959561
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

A4GNT Recombinant Protein (Human)

RP036352 100 ug Ask for price

A4GNT Recombinant Protein (Mouse)

RP113024 100 ug Ask for price

Anti-A4GNT / alpha4GNT antibody

STJ72083 100 µg
EUR 359.00

A4GNT Polyclonal Antibody, HRP Conjugated

A62027 100 µg
EUR 570.55
Description: reagents widely cited

A4GNT Polyclonal Antibody, FITC Conjugated

A62028 100 µg
EUR 570.55
Description: Ask the seller for details

A4GNT Polyclonal Antibody, Biotin Conjugated

A62029 100 µg
EUR 570.55
Description: The best epigenetics products

A4GNT ORF Vector (Human) (pORF)

ORF012118 1.0 ug DNA
EUR 354.00

A4gnt ORF Vector (Mouse) (pORF)

ORF037676 1.0 ug DNA
EUR 506.00

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx230015-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx014174
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx008159
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx037237-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx302945
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx210468
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx210469
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx324703
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx330783-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx430472-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx125472
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

A4GNT sgRNA CRISPR Lentivector set (Human)

K0014201 3 x 1.0 ug
EUR 339.00

A4gnt sgRNA CRISPR Lentivector set (Mouse)

K4191601 3 x 1.0 ug
EUR 339.00

Polyclonal Goat Anti-A4GNT / alpha4GNT Antibody

AMM04849G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-A4GNT / alpha4GNT . This antibody is tested and proven to work in the following applications:

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody (HRP)

20-abx302946
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody (FITC)

20-abx302947
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody (Biotin)

20-abx302948
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Alpha- 1,4- N- acetylglucosaminyltransferase, A4GNT ELISA

ELI-12236h 96 Tests
EUR 824.00

A4GNT sgRNA CRISPR Lentivector (Human) (Target 1)

K0014202 1.0 ug DNA
EUR 154.00

A4GNT sgRNA CRISPR Lentivector (Human) (Target 2)

K0014203 1.0 ug DNA
EUR 154.00

A4GNT sgRNA CRISPR Lentivector (Human) (Target 3)

K0014204 1.0 ug DNA
EUR 154.00

A4gnt sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4191602 1.0 ug DNA
EUR 154.00

A4gnt sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4191603 1.0 ug DNA
EUR 154.00

A4gnt sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4191604 1.0 ug DNA
EUR 154.00

A4GNT Protein Vector (Human) (pPB-His-MBP)

PV318522 500 ng
EUR 481.00

A4GNT Protein Vector (Human) (pPB-His-GST)

PV318523 500 ng
EUR 481.00

A4GNT Protein Vector (Mouse) (pPB-C-His)

PV150702 500 ng
EUR 603.00

A4GNT Protein Vector (Mouse) (pPB-N-His)

PV150703 500 ng
EUR 603.00

A4GNT Protein Vector (Mouse) (pPM-C-HA)

PV150704 500 ng
EUR 603.00

A4GNT Protein Vector (Mouse) (pPM-C-His)

PV150705 500 ng
EUR 603.00

A4GNT 3'UTR Luciferase Stable Cell Line

TU000010 1.0 ml
EUR 1394.00

A4GNT 3'UTR GFP Stable Cell Line

TU050010 1.0 ml
EUR 1394.00

A4gnt 3'UTR Luciferase Stable Cell Line

TU101066 1.0 ml Ask for price

A4GNT Protein Vector (Human) (pPB-C-His)

PV048469 500 ng
EUR 481.00

A4GNT Protein Vector (Human) (pPB-N-His)

PV048470 500 ng
EUR 481.00

A4GNT Protein Vector (Human) (pPM-C-HA)

PV048471 500 ng
EUR 481.00

A4GNT Protein Vector (Human) (pPM-C-His)

PV048472 500 ng
EUR 481.00

A4gnt 3'UTR Luciferase Stable Cell Line

TU200010 1.0 ml Ask for price

A4gnt 3'UTR GFP Stable Cell Line

TU250010 1.0 ml Ask for price

A4gnt 3'UTR GFP Stable Cell Line

TU151066 1.0 ml Ask for price

Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E01A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E01A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E01A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E02A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E02A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E02A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E03A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E03A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E03A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E04A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E04A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E04A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E07A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E07A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E07A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E06A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E06A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E06A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E08A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E08A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E08A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E09A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E09A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E09A1112-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) ELISA Kit

20-abx385530
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Guinea pig Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E05A1112-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E05A1112-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

On the contrary, when carefully handled, engineered organisms provide a unique opportunity to study biological systems in a controlled fashion. Biotechnology is a powerful tool to advance medicalresearch and should not be abandoned because of irrational fears.